aureus     RN4220 rk – mk +; accepts foreign DNA [20] RN6390 Prophage-cured wild-type strain [21] Newman Wild-type clinical isolate [22] H803 Newman sirA::Km; KmR [30] H1665 Newman Δsfa::Km; KmR [9] H1666 Newman Δsbn::Tet Δsfa::Km; TetR KmR [9] H1262 Newman Δhts::Tet; TetR [9] H1497 Newman sirA::Km Δhts::Tet; TetR KmR [9] H2131 Newman sbnA::Tc ΔsfaABCsfaD::Km This study H1718 Newman sbnB::Tc ΔsfaABCsfaD::Km This study Selleck Anlotinib Plasmids     pACYC184 E. coli cloning vector; CmR ATCC pALC2073 E. coli/S. aureus shuttle

vector; ApR CmR [26] pAUL-A Temperature-sensitive S. aureus suicide vector; EmR LcR [25] pDG1514 pMTL23 derivative carrying tetracycline resistance cassette; ApR [24] pFB5 pALC2073 A-1210477 order derivative carrying sbnA; CmR This study pSED52 pALC2073 derivative carrying sbnB; CmR This study Oligonucleotides*     Cloning of sbnA into pBC SK+ sbnA5′-SacI 5′ TGAGCTCGATTCTGTAGGGCAAACACC 3′ sbnA3′-KpnI 5′ TTGGTACCTCTAAGTAACGATCGCCTCG 3′ Amplification/cloning of a tetracycline resistance cassette from pDG1513 Tet5′-NsiI 5′ TTGTATATGCATACGGATTTTATGACCGATGA

3′ Tet3′ 5′ TGTGTGGAATTGTGAGCGGATAAC 3′ Cloning of sbnA into pALC2073 sbnA5′-XhoI 5′ TTTCTCGAGATTTTAAATTTGAGGAGGAA 3′ sbnA3′-EcoRI 5′ TTTGAATTCCCACATAAACTTGTGAATGATT 3′ Cloning of sbnB into pACYC184 sbnB5′-BamHI 5′ TTGGATCCTAGTTTATTCAGATACATGG 3′ sbnB3′-BamHI 5′ TTGGATCCTGTCCCAATATTTTGTTGTT 3′ Cloning of sbnB into pALC2073 sbnB5′-EcoRI selleck chemicals llc 5′ TTGAATTCTCAAGTGATCCATGTAGATG 3′ sbnB3′-EcoRI 5′ TTGAATTCCAATTCCGGCTATATCTTCA 3′ * underlined sequences in oligonucleotides denote restriction sites DNA and PCR preparation and purification Plasmid DNA was Protein tyrosine phosphatase isolated from bacteria using Qiaprep mini-spin kits (Qiagen), as directed. S. aureus cells were incubated for 30 min at 37°C in P1 buffer amended with 50 mg/mL lysostaphin (Roche Diagnostics) prior to addition of lysis buffer P2. Restriction enzymes, T4 DNA ligase, Klenow fragment, and PwoI polymerase were purchased from Roche Diagnostics. Pfu Turbo

polymerase was purchased from Stratagene and oligonucleotides were purchased from Integrated DNA Technologies. For all PCR reactions, genomic template was from S. aureus strain Newman. Genetic manipulation and construction of S. aureus mutants All extrachromosomal genetic constructs were created in E. coli strain DH5α and then electroporated into the restriction-deficient S. aureus strain RN4220 [20] prior to subsequent passage into other S. aureus genetic backgrounds. Chromosomal replacement alleles (namely sbnA::Tc and sbnB::Tc) were generated in strain RN6390 [21] and transduced into the Newman [22] background using phage 80α, similar to previously described methods [9, 23]. The sbnA::Tc and sbnB::Tc mutant alleles and vectors for complementing these mutations in trans were generated using methodologies previously described [9, 23].