All the predictions above were performed with PrecitedProtein web server [25, 26]. The presence and identity of both coding sequences among Leptospira YM155 order sequenced genomes are depicted in Table 1. Table 1 Gene locus, given names, features, gene conservation, sequence of the primers employed for
DNA amplification, and molecular mass of expressed recombinant proteins Gene locus1 Given name2 Description/ Function Saracatinib research buy conservation (identity)3 Sequence of primers for PCR amplification Molecular mass LIC11834 Lsa33 Putative lipoprotein Lai (99%) LBH (87%) LBP (31%) F:5′CTCGAGGATCTACAAGGTGGGGTTTTTAC3′ XhoI R:5′CCATGGTTACTGAGGTTTTACTTGGTCC3′ NcoI 33.1 kDa LIC12253 Lsa25 Conserved hypothetical protein Lai (100%) LBH (77%) LBP (39%) F:5′ CTCGAGGAGGAGAAACCGGACGATAC 3′ XhoI R:5′CCATGGTTAGGGAAGACTTCTAACACATC3′ NcoI 24.07 kDa 1 http://aeg.lbi.ic.unicamp.br/world/lic/; LIC: Leptospira interrogans Copenhageni 2Lsa: Leptospiral surface adhesin of 33 and 24 kDa; we have named the latter as Lsa25 because Lsa24 has been already described (Barbosa et al., 2006) 3 http://blast.ncbi.nlm.nih.gov/Blast.cgi/ Distribution and expression of LIC11834 and LIC12253 genes among Leptospira strains The presence of LIC11834 and LIC12253 genes in
pathogenic strains and in one saprophytic strain was examined by PCR with a pair of primers designed according to L. interrogans serovar Copenhageni genome sequences. The gene LIC11834 was amplified by PCR in all strains belonging to the pathogenic species excluding
in L. santarosai serovar Shermani (Figure 1A). No DNA amplification was detected BIBF 1120 in vivo in the non – pathogenic L. biflexa serovar Patoc. In the case of LIC12253 gene, DNA band was amplified in all pathogenic strains and a less intense band was detected in the saprophytic strain (Figure 1A). The expression of LIC11834 and LIC12253 genes was evaluated by PCR amplification of reversely transcribed total RNA. LIC11834 below gene product was detected only in L. interrogans specie serovars Canicola, Pomona, Copenhageni, Icterohaemorrhagiae and Hardjo. No expression was observed in non-pathogenic strain. LIC12253 gene expression could be identified in all pathogenic strain tested (Figure 1B). Integrity of total RNA used in RT – PCR experiments was assured by the presence of a 1,042 – bp 16 S ribosomal cDNA fragment in all samples (Figure 1B). Figure 1 Analysis of the LIC11834 and LIC12253 genes and their transcripts among different leptospiral strains. (A) Analysis by PCR of the LIC11834 (2) and LIC12253 (3) genes in pathogenic serovars (L. interrogans, L.borgpetersenii, L. kirshnery, L. noguchi and L. santarosai) and in the non – pathogenic L. biflexa strain. 16 S rRNA gene expression was used as an internal control (1). The negative control contained no DNA, indicated by (−).