BaF3 generation pJudged and BaF3 HE116 phe116 / 9 cells and selection of the autonomous cells previously described.14 The Selected frequency autonomous cells, as previously described.14 Hlt BaF3 phe116 IL 9/9 and involuntary phe116 BaF3 cells were cultured in the presence of IL-3 was , w While clones Selected adjused and verst RKT autonomous in the absence of IL-3. Extraction of RNA, AZD7762 cDNA synthesis, PCR, and sequencing lacing total RNA was prepared from 106 IL 3 dependent-Dependent BaF3 phe116, BaF3 phe116 / 9 or autonomous BaF3 clones using the reagent according to the manufacturer Tripure, instructions. Reverse transcription was on 1g Total RNA performed with an oligo-and M-MLV RT. PCR amplification was performed.
Using the cDNA corresponding Regorafenib to 20 ng of total RNA at 94 for 1 min, 58 1 min, and 72 for 2 min with a total of 39 cycles Dependent Ngig sequencing of the region of JAK1 were different S PageSever of primers for amplification and sequencing of the PCR product JAK1. PCR product was purified using technology Chromaspin: 50 100 ng of PCR product was used for sequencing with age DYEnamic ET Dye Terminator kit according to the manufacturer’s instructions. Two independently-Dependent PCR reactions were carried out to the M Possibility of Taq induced mutations w During amplification exclusively En. Interestingly, all of the nucleotides have been mutated in the murine sequence in the human JAK1 sequence conserved JAK1. Therefore, the numbering of the mutated amino Acids of the human JAK1 sequence-based so that the nomenclature currently used for JAK1 protein mutations in the literature in order to be accepted and to locate our JAK1 mutations in the three-dimensional model of the above-described structure of the human JAK1 protein .
9 reverse transcription quantitative reverse transcription PCR was performed as described above. Quantitative PCR reactions were performed using primer sets corresponding murine JAK1 or mouse actin with qPCR Mastermix for SYBR Green I. The primer sequences are as follows: MJAK1 5, 3 and 5 GGAGTGCAGTATCTCTCCTCTCT CCATGCCCAGGCACTCATTTTCA 3, 5 mActin, GCTGGAAGGTGGACAGTGAG 3, 5, 3 CTCTGGCTCCTAGCACCATGAAG. To amplify cDNA corresponding PCR conditions as used previously described.17, were analyzed using the software 18 results MyiQ. Amount of the transcription start site.
Based calibration curves from a cDNA clone Construction of plasmid DNA transfection and analysis of stable transfected cells all JAK1 and JAK2 mutants generated with QuickChange II XL site directed mutagenesis kit and were subcloned into GFP or GFP pMEGIX biscistronic PMX retroviral vector upstream Rts of the IRES as previously described.17 19, the mutated JAK1 and JAK2 constructs were verified by sequencing lacing JAK1 and JAK2 full L length with DYEnamic ET Dye Terminator Kit.for stable transduction, typically 0.5 06 BaF3 cells were incubated with retroviruses produced by BOSC packaging cells using a previously described standard protocol.20 Cells were then FACS based on the same level of GFP infected sorted. Western Blot Western blot analysis were starved 106 BaF3 cells for 4 hours and lysed in 250 L Laemmli buffer. We separated the proteins Using precast 12% Tris-glycine gels and transferred to nitrocellulose membranes.