PSMD2 (primers kindly provided by Ms Gina Oliver and Dr Claire Quilter) was selected for use as the reference gene because it was previously shown to be a good control for pig brain (personal communication from Ms Gina Oliver and Dr Claire Quilter) and

was also shown to selleck products be one of the most constant housekeeping genes in a human tissue study. Quantitative RT-PCR was performed on 300 ng RNA equivalents in 25 μL/reaction/well on an Icycler (Bio-Rad Laboratories Ltd, USA) (50°C for 60 min; 95°C for 15 min; 40 cycles of 95°C for 15 sec, 58°C for 30 sec and 72°C for 30 sec). For each gene reactions were performed in triplicate to allow statistical evaluation of the data. The average Ct (threshold cycle) was used for the analysis. Relative expression levels were calculated by using the 2-(ΔΔCt) method as previously described [16]. Table 1 validation of array data

by real-time BMN673 PCR       selleck Microarray data qRT-PCR data Gene name Pig homologene Primer sequences (5′-3′) Brain (n-fold change) Lung (n-fold change) Brain (n-fold change) Lung (n-fold change) PSMD2 Ssc.1642 F: tggggagaataagcgttttg R: tattcatgaccccatgatgc Ref Ref Ref Ref AKT1 Ssc.29760 F: tgggcgacttcatccttg R: tggaagtggcagtgagca NDa 1.68 ND 2.19 CDC42 Ssc.6687 F: aaagtgggtgcctgagata R: ctccacatacttgacagcc -b 2.03 – 7.38 LY96 Ssc.25550 F:cattgcacgaagagacataca R: tgtattcacagtctctcccttc 1.37 3.32 6.91 9.23 PIK3R1 Ssc.49949 F: cccaggaaatccaaatga R: ggtcctcctccaaccttc – - 0.61 0.45 SERPINE1 Ssc.9781 F: ccagcagcagatccaaga R: cggaacagcctgaagaagt

-1.66 2.36 -0.64 4.28 aND, not done; b-, not changed or absent. Results Microarray analysis of gene expression profiles in brain and lung Six brain samples and four lung samples were used for microarray hybridization and qRT-PCR, and two of the lung samples were excluded as they were found to be degraded. Table 2 shows the number of differentially expressed human probe sets initially identified in brain and lung tissues (p-value < 0.01 and p-value < 0.05). Based on BLAST analysis, those probes with putative pig gene homologues have been considered for further analysis and numbers are shown in table 2. This avoids making assumptions about other probes that detect expression changes but have weaker matches to pig ESTs. Most probes with porcine homologues remained unchanged, and few showed a reduction in transcription GPX6 level by microarray analysis. For example, expression of only 4 (60-70 bp human match category) and 1 (50-59 bp human match category) were decreased in infected lung tissue (p-value < 0.01). In contrast, a large number of host transcripts were induced in response to wild type PRV infection (table 2). Here we identified 120 and 866 up-regulated transcripts in brain and lung (p-value < 0.01) with pig: human matches ≥ 60 bp, and 42 and 259 genes with matches of 50-59 bp for further gene ontology and pathway classification (table 2).